1.Mapping, Annotation and QC
Pipeline

Data Structure
"genomes/hg38/" # reference genomes (i.e. genome sequence and annotation)
"shared_scripts/" # shared scripts by Lu Lab
~/github # I sync my own scripts to github
~/proj_exRNA/
|-- RNA_index # rerference transcriptomes (fasta and index)
|-- sample*_name # ...
|-- sample2_name # different samples
`-- sample1_name
|-- fastq # raw data: fastq files
|-- fastqc # QC of fastq
|-- trim # trimmed fastq (e.g. 3' adaptor cutted)
`-- mapped # mapped data: SAM/BAM filesInputs
File format
Information contained in file
File description
Notes
fastq
reads
small RNA-seq reads from single-end libraries.
This will be processed from long reads we got. Raw reads are trimmed as single-ended, 50nt clean reads (see details in the protocol and example).
fasta
genome/transcriptome sequences
sequences of the whole human genome or different RNAs (transcriptome)
gtf / gff
genome annotation
Default genome annotation file is from GENCODE, mirBase, etc.
Be careful about exon and intron for mRNA/lncRNA, precursor and mature product for miRNA.
Outputs
File format
Information contained in file
File description
Notes
sam/bam
alignments, i.e. mapped reads (bam is a binary format of sam)
Produced by mapping reads to transcriptome
We map to transcriptome for a better sensitivity (see details in protocol and example).
bt2
indexed sequences
Indexed genome/ transcriptome
Different ncRNA types are indexed separately and mapped sequentially.
Running Scripts
Software/Tools
RSEM: index and many utility package for transcriptome analysis
fastqc: QC for fastq file
cutadapt: trim and cut adaptor
bowtie2: mapping
Example of single case
# genome seuqneces and annotaions
ln -s /BioII/lulab_b/shared/genomes $HOME/genomes
export hg38=$HOME/genomes/human_hg38/sequence/GRCh38.p10.genome.fa
export gtf=$HOME/genomes/human_hg38/anno/gtf
export index=$HOME/genomes/human_hg38/index/transcriptome_rsem_bowtie2
# raw data (fastq files)
cd $HOME/proj_exRNA/example/fastq
ln -s /BioII/lulab_b/shared/projects/exRNA/example/100K/*.fastq .
# working space
cd $HOME/proj_exRNA# Produce indexed transcriptome, using miRNA as an example
# Usually, you do not need to do this because we have already index one
# in "$index"
# We need RSEM to index transcriptome (RNAs) because we'll convert
# the relative coordinates to genomic coordinats after mapping to RNAs
#############################################################
# 0: build bowtie2 index using RSEM for RNA transcriptome
#############################################################
rsem-prepare-reference --gtf $gtf/miRNA.gencode27.gtf --bowtie2 $hg38 \
RNA_index/miRNA.gencode27 > log.0 2>err.0 &
# RSEM will take exons only
# only if you prepare gtf files in the right format# check raw reads' quality
# trim low quality ends + keep first 50nt + remove 3' adapter
#############################################################
# 1.1: fastaqc - repeat fastqc before and after each trim step
#############################################################
fastqc -q -o example/fastqc NC_1.fastq \
> log.1.1 2>err.1.1 &
#output the QC files to a dir examples/fastqc
#############################################################
# 1.2: trim - cut adaptor + trim long read
#############################################################
cutadapt -u -100 -q 30,30 --trim-n -m 15 -a \
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -o NC_1.fastq.trim NC_1.fastq
# -u -100 remove last 100nt so that the first 50nt is kept
# -q 30,30 read quality need to be above 30
# -m 15 reads less than 15nt are removed
#############################################################
# repeat 1.3 QC after 1.2 Trim
# make sure the low quality reads have been removed and/or trimmed.
#############################################################
fastqc -q -o example/fastqc NC_1.fastq.trim \
> log.1.3 2>err.1.3 &#############################################################
# 1.4: clean rRNA reads
#############################################################
cd $proj/fastq
for i in `ls *.fastq` ; do
sample="${i/.fastq/}"
sam=$sample.rRNA.sam
bam=$sample.rRNA.bam
fqin=$sample.fastq.trim
fqout=$sample.no_rRNA.fq
RNA=$index/rRNA
echo "start $sample :"
bowtie2 -p 4 --sensitive-local --norc --no-unal --un ../mapped/$fqout \
-x $RNA $fqin -S ../mapped/$sam
#map to rRNAs (exons only, sense strand only)
# (default) look for multiple alignments, report best, with MAPQ
# --sensitive-local(default): allow no mismatch, etc
# --norc: do not align reverse-complement version of read
# --no-unal: suppress SAM records for unaligned reads
# --un: store unmapped reads
# -x: indexed genome/transcriptome
# -S: output file foramt as sam
samtools view -b ../mapped/$sam > ../mapped/$bam
#convert sam to bam for mapped reads on rRNAs (sense strand)
echo "$sample finished."
done# map to different RNAs (transcriptome) step by step
#############################################################
# 1.5 align cleaned reads to transcriptome (different RNAs)
# first align to miRNAs
#############################################################
cd $proj/fastq
for i in `ls *.fastq` ; do
sample="${i/.fastq/}"
fqin=$sample.no_rRNA.fq
fqout=$sample.no_miRNA.fq
sam=$sample.miRNA.sam
bam=$sample.miRNA.bam
RNA=$index/miRNA
echo "start $sample :"
bowtie2 -p 4 --sensitive-local --norc --no-unal --un ../mapped/$fqout \
-x $RNA ../mapped/$fqin -S ../mapped/$sam
#map to miRNAs (pre-miRNA or pri-miRNA, sense strand only)
# (default) look for multiple alignments, report best, with MAPQ
# --sensitive-local(default): allow no mismatch, etc
# --norc: do not align reverse-complement version of read
# --no-unal: suppress SAM records for unaligned reads
# --un: store unmapped reads
# -x: indexed genome/transcriptome
# -S: output file foramt as sam
samtools view -b ../mapped/$sam > ../mapped/$bam
#convert sam to bam for mapped reads on miRNAs (sense strand)
echo "$sample finished."
done
##############################################################
# then align to next RNA (e.g. piRNA)
# repeat mapping ...Tips/Utilities
A better view of gff/gtf file
less -S *.gff # chop long lines rather than wrap themConvert gff to gtf
gffread tRNA.gff -T -o tRNA.gtfLift over gff/bed/bam version
# convert bed
liftOver old.bed map.chain new.bed unmapped
# convert gtf
## option 1: simple method (not recommended)
liftOver -gff old.gtf map.chain new.gtf unmapped
### -gff File is in gff/gtf format. Note that the gff lines are converted
### separately. It would be good to have a separate check after this
### that the lines that make up a gene model still make a plausible gene
### after liftOver
## option 2: conver to genePred format first
gtfToGenePred -genePredExt old.gtf old.gp
liftOver -genePred old.gp map.chain new.gp unmapped
genePredToGtf file new.gp new.gtfCollapse duplicated reads
Not needed for sRNA-seq.
#option 1: collapse before mapping
fastx_collapser -Q 33 -i input.fastq -o output.collapsed.fastq
#option 2: Collapse after mapping
samtools rmdup -s sorted.bam output.dedup.bam
java -jar picard.jar MarkDuplicates \
I=input.bam \
O=output.markDuplicates \
M=output.metric \
REMOVE_DUPLICATES=trueHomework and more
1 Map on example data
Map the example fastq files and summarize the distribution of 1) reads' length and 2) reads' percentage for each type of RNA (e.g. miRNA, piRNA, Y RNA, srp RNA, etc) **. (You may find some script examples for this statistics calculation from this link.)
2 Sample QC
Use the following criteria to QC the mapped samples for cfRNAs (exRNAs):
Check point
Threshold
Notes
Raw reads quality
reads quality >28 (median lines in green area)
Check fastqc results(*.html)
Clean reads number
> 10 million
Adaptors and too-short sequences removed reads
rRNAs%
< 10%
Reads mapped to rRNAs (all following % are divided by the total number of clean reads)
HG%
> 60% (optional)
Reads mapped to Human Genome except rRNAs
Transcriptome%
> 50%
Reads mapped to Human Transcriptome (including rRNA, miRNA, piRNA, Y RNA, srpRNA, snRNA, snoRNA, tRNA, mRNA exons, lncRNA exons, TUCP exons)
Y RNA%
10%~65%
Reads mapped to Y RNA
miRNA%
10%~65% (up to 80% for exoRNAs)
Reads mapped to miRNA
3 A fast multi mapping methods to test different mapping orders
3.1 Why use this method: We want to determine a satisfying mapping order by examine the mapping ratio and length distribution. It takes hours to map and collect statistics from a specific order. We use a special method, using python (numpy) to manipulate matrix. By using this method, we can test hundreds of mapping order within few minutes.
3.2 Scripts
At first we do mapping for all RNAs at one time, we use this snakefile and config file to do mapping at one time. (One map snakefile. One map config.)
Secondly we do some matrix manipulation tricks. Using numpy to do matrix indexing and sorting is ultra fast. By using some tricks, we can have the desired statistics within few minutes for hundreds of different mapping orders: (Mapping order for ratio. Mapping order for length distribution)(You can find some tries and tests of the mapping order methods and statistics and plot jupyter notebook here: Statistics and plot)
At last we also extend our algorithm, we can create a big dictionary to store all the possible mapping assignment in every order and every one map condition. We encode the binary condition sequence into 10-bit digits. And store the whole dictionary together. It can test up to 100,000 kinds of mapping order within few hours. The jupyter-notebook presents the main idea of this method. (Ultra-fast mapping methods)
Additional Tutorial: 1.preprocessing_mapping_QC
Introduction to exRNA-seq;
Mapping, Annotation and QC
Week V - PARTII.1.Mapping etc - Wang
Week VI - PARTII. 2. run your job - example 1 bash
Bioinformatics Data Skills
10) Working with Sequence Data
Video
a) Mapping
b) Run your job example in bash
Last updated
Was this helpful?